datp (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
97
Structured Review
New England Biolabs
datp
Datp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 333 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/datp+solution/dATP+Solution/bio_rxiv__64898__2026__04__30__722071-422-56-57
Average 97 stars, based on 333 article reviews
Datp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 333 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/datp+solution/dATP+Solution/bio_rxiv__64898__2026__04__30__722071-422-56-57
Average 97 stars, based on 333 article reviews
datp - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
other:Article Title: The twist-and-squeeze activation of CARF-fused adenosine deaminase by cyclic oligoadenylates Article Snippet: In Situ:Article Title: DROSHA, DICER, and damage-induced long ncRNA control BMI1-dependent transcriptional repression at DNA double-strand break. Article Snippet: Coverslips were then washed twice in 1× rCutSmart buffer (NEB; #B6004S) and twice in 1×T4 ligase buffer (NEB; #B0202S). .. Then, in situ ligation was performed overnight at 16◦C in a sealed humid chamber, in 100 μL final volume per coverslip using: 2 μL T4 Ligase (NEB; #M0202S), 5 μL 10 μM biotinylated linker (5′-TACTACCTCG AGAGTTACGCTAGGGA- TAACAGGGTAATATAGTTT[biotin–dT]TTTCTATATTACCCTGTTA- TCCCTAGCGTAACTCTCGAGGTAG TA-3′), 10 μL 10× T4 Ligase Buffer (NEB; #B0202S), 1 μL Article Title: Rewiring of 3D chromatin topology orchestrates transcriptional reprogramming in muscle fiber-type specification and transformation Article Snippet: The SDS was quenched by the addition of 145 μl H 2 O and 12.5 μl 20% Triton X-100, and the genome was digested overnight at 37 °C with 100U AluI (NEB, R0137V) into blunt-end fragments. .. Cleaved chromatin was A-tailed by adding 10 mM Article Title: DROSHA, DICER, and damage-induced long ncRNA control BMI1-dependent transcriptional repression at DNA double-strand break Article Snippet: Coverslips were then washed twice in 1× rCutSmart buffer (NEB; #B6004S) and twice in 1×T4 ligase buffer (NEB; #B0202S). .. Then, in situ ligation was performed overnight at 16°C in a sealed humid chamber, in 100 μL final volume per coverslip using: 2 μL T4 Ligase (NEB; #M0202S), 5 μL 10 μM biotinylated linker (5′-TACTACCTCGAGAGTTACGCTAGGGA- TAACAGGGTAATATAGTTT[biotin–dT]TTTCTATATTACCCTGTTA- TCCCTAGCGTAACTCTCGAGGTAGTA-3′), 10 μL 10× T4 Ligase Buffer (NEB; #B0202S), 1 μL Ligation:Article Title: DROSHA, DICER, and damage-induced long ncRNA control BMI1-dependent transcriptional repression at DNA double-strand break. Article Snippet: Coverslips were then washed twice in 1× rCutSmart buffer (NEB; #B6004S) and twice in 1×T4 ligase buffer (NEB; #B0202S). .. Then, in situ ligation was performed overnight at 16◦C in a sealed humid chamber, in 100 μL final volume per coverslip using: 2 μL T4 Ligase (NEB; #M0202S), 5 μL 10 μM biotinylated linker (5′-TACTACCTCG AGAGTTACGCTAGGGA- TAACAGGGTAATATAGTTT[biotin–dT]TTTCTATATTACCCTGTTA- TCCCTAGCGTAACTCTCGAGGTAG TA-3′), 10 μL 10× T4 Ligase Buffer (NEB; #B0202S), 1 μL Article Title: Rewiring of 3D chromatin topology orchestrates transcriptional reprogramming in muscle fiber-type specification and transformation Article Snippet: The SDS was quenched by the addition of 145 μl H 2 O and 12.5 μl 20% Triton X-100, and the genome was digested overnight at 37 °C with 100U AluI (NEB, R0137V) into blunt-end fragments. .. Cleaved chromatin was A-tailed by adding 10 mM Article Title: DROSHA, DICER, and damage-induced long ncRNA control BMI1-dependent transcriptional repression at DNA double-strand break Article Snippet: Coverslips were then washed twice in 1× rCutSmart buffer (NEB; #B6004S) and twice in 1×T4 ligase buffer (NEB; #B0202S). .. Then, in situ ligation was performed overnight at 16°C in a sealed humid chamber, in 100 μL final volume per coverslip using: 2 μL T4 Ligase (NEB; #M0202S), 5 μL 10 μM biotinylated linker (5′-TACTACCTCGAGAGTTACGCTAGGGA- TAACAGGGTAATATAGTTT[biotin–dT]TTTCTATATTACCCTGTTA- TCCCTAGCGTAACTCTCGAGGTAGTA-3′), 10 μL 10× T4 Ligase Buffer (NEB; #B0202S), 1 μL Generated:Article Title: Improved Cas9-targeted nanopore sequencing facilitates ultra-deep analysis of genomic variation. Article Snippet: .. The complete reaction was used for Cas9 cleavage and dA-tailing using the previously generated Cas9 RNPs, Taq polymerase (NEB M0273), and 100 mM |